I had installed notepad++ using Softwares in my Ubuntu 18.04, which installed notepad++ using snap. Now, for some reason, my notepad++ is not opening. But I want to get all the unsaved text files I had opened in my previous session. Where can I find these unsaved files? Most of the questions on web deal … Read more
How to completely remove Notepad++ in Ubuntu 18.04 terminal? I can’t find it in Synaptic package manager, and don’t know where is on system, but I can see an icon in Activity. It is probably not completely installed, because I can’t open it. Answer Notepad++ (notepad-plus-plus) is a snap package in the default repositories of … Read more
Is there a way to have Notepad++ generate new file names with the current date? Like this: YYYY_MM_DD_new1.txt or similar. Currently it just names them: new1, new2, etc. Date in the file name will work great with autosave, there will be no name conflicts after NPP restart. All I want is a way to store … Read more
I am trying to find and replace an arrangement of 6 letters\special character\numbers. For example they appear as such in my original code DEVICE_NAME”,”CB2_02 DEVICE, DEVICE_NAME”,”CB3_09 DEVICE, DEVICE_NAME”,”OB6_12 DEVICE… The order in which the letters, numbers, and special character appear are always the same. I need to replace the _ (underscore) between CB3_09 with a … Read more
How can you set notepad++ to always start in a new window? Whenever I open it, it always starts with the last saved document I have. I know you can click the button new window or use alt f6, but is there a way to open without having to do that? Answer Settings > Preferences … Read more
I want to remove spaces from a list of phone numbers. The phone numbers are in the following format: “+33 x xx xx xx xx” most of the time (quotes included). Spaces can be placed differently. In notepad++, my “Find what:” field looks like this, and effectively matches every phone number encountered: “\Q+\E[0-9 ]+”. But … Read more
Its a simple question.Once I perform a search in notepad++ .Is there any posibility to search something in the result of the fisrt search? Edit. Sometimes i have to do some reports about logs and i have to find some information.In most of the cases i can manage easyly by using regexp but in some … Read more
I have a fasta file containing genome sequences of multiple viruses. Example: >gi_138375030_Human_papillomavirus GAAAGTTTCAATCATACTTTATTATATTGGGAGTAAAAAAAA… >gi_94481944_Human_herpesvirus_3 GGCCCAGCCCTCTCGCGGCCCCCTCGAGAGAGAAAAAAA… I want to extract only herpes virus entries, including the actual sequence, which is (in this file) always the line folowing the description. The folowing regex works: >.*herpes.*\n.*\n It selects the description and the sequence lines. I have found … Read more
I am using Notepad++ to cleanup some wiki code and would like to do the following: I need to remove all leading spaces from a line but only if the first non-space character is a letter. Here’s an example: Input: This should be changed * This should not be changed //This souldn’t be changed either … Read more
How do I remove the last column from a comma delimited file in notepad++ using regex with replace and find? This is my file: 2010-09-02,148.67,31.34,0,0,31.34 2010-09-03,149.52,31.24,0,0,31.24 … I am trying to find this pattern at the end of each line, basically the last column or everything after the last comma, for example: ,31.34 ,31.34 This … Read more
